19+ puc-gw-kan vector

We have developed a novel binary vector series named the PC-GW series GenBank. KP826769-KP826773 for Agrobacterium-mediated plant transformation.

Looking Back A Short History Of The Discovery Of Enzymes And How They Became Powerful Chemical Tools Heckmann 2020 Chemcatchem Wiley Online Library

Vector name pUC19 phagemid.

. Easy one step selection of recombinant colonies. With twenty years of gene synthesis and custom cloning experience we can clone into any vector. 1 pUC57Kan Vector Map Multiple Cloning Sites.

Many restriction sites in MCS Multiple Cloning Sites Disadvantage. The PC-GW vectors use the. These plasmids are 2700 bp long and contains.

The pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. M13F 47 M13 XapI SacI KpnI Bsp68I 5 C GCC AGG GTT T T C CCA GTC ACG ACG T T G TAA AAC GAC GGC CAG AGA ATT CGA GCT CGG. S8 dq 6htxhqfh es 777777777777 77777777777.

Advantages of pUC vector. SnapGene Viewer is free software that allows molecular biologists to create browse and share richly annotated sequence files. PHSG298 is a kanamycin-resistant pUC cloning vector which contains the same consensus multicloning site as pUC18 though Hind III and Sma I sites are not available.

The molecule is a small double-stranded circle 2686 base pairs in length and has a high copy. PUC-GW-Kan Search Vector Database. Eurofins Genomics Blue Heron provides several vector options for your convenience.

This is a free resource for the scientific community that is. Gain unparalleled visibility of your plasmids DNA and protein. PUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.

PUC vectors used as cloning vectors and they belong to pUC series named after the place of their initial preparation ie. High copy number 500-600 copies per cell. The designation pUC is derived from the classical p prefix denoting plasmid and the.

PUC19 is a commonly used cloning vector that conveys the Amp resistance. Pathway ORF Kits. Vector database is a digital collection of vector backbones assembled from publications and commercially available sources.

The assembled full-length gene is cloned into the pUC-GW-KanAmp vector via the EcoRV site. Pathways ORFs. Puc-gw-kan sequence 2626bp tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagactgtcacagcttgtctgtaagcggatgccg.

The final construct is verified with both Sanger DNA sequencing on at least one strand and.

Addgene Plenti6 Ubc Mslc7a1

Strategic Modulation Of Target Specific Isolated Fe Co Single Atom Active Sites For Oxygen Electrocatalysis Impacting High Power Zn Air Battery Acs Nano

Addgene Prsii416

Mneongreen Tagged Fusion Proteins And Nanobodies Reveal Localization Of Tropomyosin To Patches Cables And Contractile Actomyosin Rings In Live Yeast Cells Biorxiv